Το PCR δεν ανιχνεύει τον SARS-CoV-2 ..Η απάτη επιβεβαιώθηκε

5/5 (2)

Οι γενετικές αλληλουχίες που χρησιμοποιούνται στην PCR για την ανίχνευση ”υποπτων περιπτώσεων SARS--2” και για τη διάγνωση φορέων, ασθενών και θανάτων που αποδίδονται στην Covid-19υπάρχουν σε δεκάδες αλληλουχίες του ίδιου του ανθρώπινου γονιδιώματος και σε αυτές εκατό περίπου μικροβίων.

Και αυτό περιλαμβάνει τους  τους εκκινητές, τα πιο εκτεταμένα θραύσματα που λαμβάνονται τυχαία από το υποτιθέμενο ”γονιδίωμα” τους και ακόμη και τα λεγόμενα ”γονίδια στόχους” που φέρεται να είναι ειδικά για τον ”νέο κοροναϊό”.

Το τεστ είναι άχρηστο και όλα τα “θετικά” αποτελέσματα που έχουν ληφθεί μέχρι τώρα θα πρέπει να είναι επιστημονικά άκυρα και να κοινοποιηθεί αυτό σε εκείνους που ‘εχουν επηρεαστεί και αν έχουν πεθάνει, στους συγγενείς τους. Ο Stephen Bustin, ένας από τους κορυφαίους εμπειρογνώμονες στον κόσμο για την PCR, στην πραγματικότητα λέει ότι κάτω από ορισμένες συνθήκες ο καθένας μπορεί να βγεί θετικός!

Σας προειδοποιήσαμε από τον Μάρτιο: δεν μπορείτε να κάνετε συγκεκριμένες δοκιμές για έναν ιό χωρίς να γνωρίζετε τα συστατικά του ιού που προσπαθείτε να εντοπίσετε.

Και τα συστατικά δεν μπορούν να είναι γνωστά χωρίς προηγουμένως να απομονωθεί / καθαριστεί αυτός ο ιός. Από τότε συνεχίζουμε να συλλέγουμε στοιχεία ότι κανείς δεν έχει απομονώσει το SARS-CoV-2 και, το πιο σημαντικό, ότι δεν μπορεί ποτέ να απομονωθεί για τους λόγους που εξηγήσαμε τον περασμένο μήνα (διαβάστε την έκθεση “Μπορείτε να αποδείξετε ότι υπάρχουν παθογόνοι ιοί;” στον ιστότοπό μας -www.dsalud.com-). Και στην παρούσα έκθεση πρόκειται να προσφέρουμε νέα δεδομένα που δείχνουν ότι το RT-PCR δεν ανιχνεύει το λεγόμενο SARS-CoV-2 όπως είναι γνωστό, αλλά θραύσματα του ανθρώπινου RNA και εκείνα πολλών μικροβίων.

Έχουμε ήδη εξηγήσει τα πολυάριθμα προβλήματα που θέτει το RT-PCR, αναγνωρισμένα από οργανισμούς ή κυβερνήσεις όπως η ΠΟΥ ή το CDC και από διάσημους διεθνείς ειδικούς όπως ο Stephen Bustin που θεωρεί ότι η αυθαιρεσία καθορισμού κριτηρίων για τα αποτελέσματα και η επιλογή του αριθμού των κύκλων είναι ανοησία επειδή μπορούν να οδηγήσουν σε οποιονδήποτε θετικό.

Σε αυτήν την έκθεση πρόκειται να προσθέσουμε τα αποτελέσματα μιας συγκεκριμένης έρευνας που κάναμε από τα δεδομένα που δημοσιεύθηκαν για τον υποτιθέμενο SARS-CoV-2 και στα πρωτόκολλα που εγκρίθηκαν από την ΠΟΥ για τη χρήση του RT-PCR καθώς και τα αντίστοιχα δεδομένα στους υπόλοιπους ”ανθρώπινους κοροναϊούς”.

Και τα συμπεράσματα είναι εξαιρετικά σοβαρά:

κανένας από τους επτά ‘‘ανθρώπινους κοροναϊούς” δεν έχει πραγματικά απομονωθεί και όλες οι ακολουθίες των εκκινητών των αντίστοιχων PCR τους, καθώς και εκείνες ενός μεγάλου αριθμού θραυσμάτων των υποτιθέμενων γονιδιωμάτων τους βρίσκονται σε διαφορετικές περιοχές  του ανθρώπινου γονιδιώματος και σε γονιδιώματα βακτηρίων και αρχαίων, όπως αυτά:

Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis και μια μεγάλη λίστα με άλλους.


Θα εξηγήσουμε βήμα-βήμα την έρευνα που μας οδήγησε σε ένα τόσο ασυνήθιστο συμπέρασμα.


Κατά το πρώτο εξάμηνο του Απριλίου, όταν η πρώτη έρευνα που κάναμε έδειξε ότι ο SARS-CoV-2 δεν ήταν απομονωμένος και δεδομένου ότι αυτοί που ισχυρίστηκαν ότι το έπραξαν βασίζονταν σε “απομονώσεις” προηγούμενων “ανθρώπινων κοροναϊών”, αρχίσαμε να κάνουμε μια εμπεριστατωμένη ανασκόπηση αυτών των ”απομονωμένων προϊόντων”.

Συγκεκριμένα, εξετάσαμε την υποτιθέμενη εργασία απομόνωσης ύποπτων ανθρώπινων κοροναϊών 229Ε (λέγεται ότι έχει απομονωθεί το 1965), OC43 (το 1967), SARS-CoV (το 2003), NL63 (το 2004), HKU1 (το 2005) και MERSCoV (το 2012). Και αυτά ήταν τα αποτελέσματα:

Coronavirus 229Ε.

Άρθρο αναφοράς: Dorothy Hamre και John Procknow. Ένας νέος ιός που απομονώνεται από την ανθρώπινη αναπνευστική οδό. Πρακτικά της Εταιρείας Πειραματικής Βιολογίας και Ιατρικής, 121: 1: 190-193. 1 Ιανουαρίου 1966.

Δεδομένου ότι οι συγγραφείς αναφέρονται σε άλλα άρθρα για να εξηγήσουν τη μέθοδο απομόνωσης – την οποία ονομάζουν Complement Fixation – συμβουλευτήκαμε ένα άρθρο αναφοράς για αυτήν τη μέθοδο: αυτό των Janet W. Hartley et al.

Συμπλήρωμα Διόρθωση και δοκιμασία ιστοκαλλιέργειας για ιούς λευχαιμίας ποντικού PNAS, 53 (5): 931-938, Μάιος 1965. Αυτή είναι μια διαδικασία που έχει ήδη χρησιμοποιηθεί, που χρησιμοποιεί την αντίδραση αντιγόνου-αντισώματος για να ανιχνεύσει το ένα ή το άλλο. Στην περίπτωση που αντιμετωπίζουμε, ο στόχος ήταν να ανιχνευθούν τα αντιγόνα του υποτιθέμενου νέου ιού, αλλά, όπως έχουμε ήδη εξηγήσει, απαιτούνται ειδικά αντισώματα που όμως δεν μπορούν να ληφθούν την πρώτη φορά που ανιχνεύεται ένας ιός.

Coronavirus OC43.

Άρθρο αναφοράς: Paul Lee. Μοριακή επιδημιολογία ανθρώπινου κοροναϊού OC43 στο Χονγκ Κονγκ. Διατριβή για το Τμήμα Μικροβιολογίας, Πανεπιστήμιο του Χονγκ Κονγκ, Αύγουστος 2007. Το HKU Scholars Hub.

Αυτό που θεωρήθηκε ιικό RNA εξήχθη από καλλιέργειες χωρίς καμία απόδειξη ότι το RNA ανήκει σε έναν ιό. Το εργαλείο που χρησιμοποιείται – ένα κιτ QIAamp – αφαιρεί τα αντιδραστήρια, τους αναστολείς και τους μολυσματικούς παράγοντες, αλλά αυτό που δεν μπορεί να κάνει είναι να προσδιορίσει από πού προέρχεται το εξαγόμενο RNA.

Και δεν υπάρχουν έλεγχοι. Εν συνεχεία ενισχύεται με PCR και προσδιορίζεται η αλληλουχία υποθέτοντας (!) Ότι είναι γενετικές πληροφορίες ενός ιού. Τέλος, ο συγγραφέας εικάζει για τις μεταλλάξεις, τους ανασυνδυασμούς, τους γονότυπους, τη μοριακή εξέλιξη, τα στελέχη και άλλη ορολογία που μεταδίδει την ιδέα – μη αποδεδειγμένη – ότι ένας ”ιός” δουλεύει.

SARS-CoV Coronavirus.

Άρθρο αναφοράς: J. S. M. Peiris και άλλοι. Ο κοροναϊός ως πιθανή αιτία του SARS. Lancet 361: 1319-25, Απρίλιος 2003.

Δεν υπάρχει αναφορά στον καθαρισμό στο άρθρο. Δεν υπάρχει καν αναφορά για φιλτράρισμα ή φυγοκέντρηση. Αναφέρεται μόνο ότι “οι ιοί απομονώθηκαν σε εμβρυϊκά ηπατικά κύτταρα πιθήκου από ρινοφαρυγγικές αναρροφήσεις και βιοψίες πνευμόνων δύο ασθενών”.

Δεν υπάρχουν έλεγχοι. Η μόνη αναφορά είναι για μια ‘‘κυτταροπαθητική επίδραση’‘ που αποδίδεται σε έναν ιό και ότι η PCR έγινε για γνωστούς ιούς και ρετροϊούς χωρίς να ληφθούν αποτελέσματα. Τέλος, το RT-PCR έγινε με “τυχαίους εκκινητές” και ανιχνεύεται μια ακολουθία “άγνωστης προέλευσης” στην οποία βρίσκεται “μια αδύναμη ομολογία με την οικογένεια coronaviridiae”. Στη συνέχεια, σχεδίασαν εκκινητές για αυτήν την ακολουθία και κατά τη δοκιμή 44 δειγμάτων από ασθενείς με SARS μόνο 22 ήταν θετικά.

Coronavirus NL63.

Άρθρο αναφοράς: Lia van der Hock και άλλοι. Αναγνώριση νέου ανθρώπινου κοροναϊού. Nature Medicine, 10, 4 Απριλίου 2004.

Οι συγγραφείς δηλώνουν ότι “η ταυτοποίηση άγνωστων παθογόνων με τη χρήση εργαλείων μοριακής βιολογίας είναι δύσκολη επειδή η αλληλουχία στόχος δεν είναι γνωστή, έτσι ώστε να μην μπορούν να σχεδιαστούν συγκεκριμένοι εκκινητές PCR”.

Αυτό που χρησιμοποίησαν είναι ένα εργαλείο που ανέπτυξαν οι ίδιοι που ονομάζονται VIDISCA το οποίο, σύμφωνα με τους ισχυρισμούς, δεν απαιτεί προηγούμενη γνώση της ακολουθίας!

Είναι πιθανό αυτό;; Ας δούμε πώς λειτουργεί: πρώτα προετοιμάζεται η καλλιέργεια και υποτίθεται ότι υπάρχει ένας ιός λόγω των ενδείξεων της ”κυτταροπαθητικής επίδρασης”. Η καινοτομία που εισάγεται με αυτήν τη μέθοδο είναι ότι προστίθενται “περιοριστικά ένζυμα”, ένζυμα που κόβουν τα μόρια νουκλεϊνικού οξέος σε ορισμένες θέσεις και πάντα με το ίδιο μήκος. Με αυτόν τον τρόπο, εάν μετά τη δράση αυτών των ενζύμων παρατηρούν πολλά θραύσματα DNA ή RNA που είναι τα ίδια ή πολύ παρόμοια, συμπεραίνουν ότι προέρχεται από έναν ιό, δεδομένου ότι το γονιδίωμα του ξενιστή θα παρουσίαζε τυχαίες περικοπές, ενώ το γονιδίωμα του ιού μεγάλο αριθμό αντιγράφων που είναι το ίδιο λόγω της αντιγραφής του ιού. Και είναι σωστή μια τέτοια έκπτωση; Φυσικά και όχι!

Αυτή η υπόθεση (η οποία προσθέτει στην προηγούμενη υπόθεση ότι υπάρχει ιός) δεν λαμβάνει υπόψη ότι υπάρχουν “σωματίδια που μοιάζουν με ιό”, “σωματίδια που μοιάζουν με ρετροϊό“, “ενδογενείς ρετροϊοί”“εξωσώματα”“εξωκυτταρικά” σωματίδια και ακόμη και μιτοχονδριακό DNA. Σε αντίθεση, υπάρχει ένα πλήθος σωματιδίων που έχουν τα ίδια αναπαραγωγικά χαρακτηριστικά σε μεγάλες ποσότητες με τους ”ιούς” και ως εκ τούτου μπορούν να παραποιήσουν τα αποτελέσματα παράγοντας μεγάλο αριθμό πανομοιότυπων αντιγράφων όταν κόβονται από ένζυμα όπως αναγνωρίζεται σε ένα άρθρο της τεχνικής VIDISCA με τίτλο Enhanced bioinformatic proSling του VIDISCA libraries for virus detection and Discovery.

Δημοσιεύτηκε στον τόμο 263 του Virus Research στις 2 Απριλίου 2019, και οι συγγραφείς του -Cormac M. Kinsella et al.-αναγνωρίζουν ότι ”δεν αναμένεται πλεονασμός στο ένθετο VIDISCA από το νουκλεϊκό οξύ υποβάθρου του ξενιστή εκτός από την περίπτωση που  χαρακτηριστικά που μοιάζουν με ιούς, δηλαδή υψηλούς αριθμούς αντιγράφων όπως στο μιτοχονδριακό DNA.

Coronavirus HKU1.

Άρθρο αναφοράς: Patrick C. Y. Woo και άλλοι. Χαρακτηρισμός και πλήρης ακολουθία γονιδιώματος ενός νέου Coronavirus, Coronavirus HKU1, από ασθενείς με πνευμονία. Δημοσίευση της ιολογίας, 79, 2, Ιανουάριος 2005.

Το άρθρο ξεκινά απίστευτα με τις εξής λέξεις: “Παρά την εκτενή έρευνα σε ασθενείς με λοιμώξεις του αναπνευστικού συστήματος, δεν έχει εντοπιστεί μικροβιολογική αιτία σε σημαντικό ποσοστό ασθενών. Το RNA εξάγεται από μη καθαρισμένες καλλιέργειες.”

Και χρησιμοποιείται ένα PCR με γονίδια κορανοϊού. Για την αλληλούχιση χρησιμοποιούν δύο βάσεις δεδομένων πρωτεϊνών που οργανώνονται σε οικογένειες, τομείς και λειτουργικές τοποθεσίες –PFAM και INterProScan– σε συνδυασμό με δύο προγράμματα υπολογιστών που εκτελούν ”προβλέψεις” για το πώς πρέπει να συνδυαστούν τα νουκλεοτίδια. Το κείμενο προσθέτει: “Οι αλληλουχίες συναρμολογήθηκαν και επεξεργάστηκαν χειροκίνητα για να παράγουν μια τελική αλληλουχία του ιικού γονιδιώματος”. Και για άλλη μια φορά δεν υπάρχουν έλεγχοι.

MERS-CoV Coronavirus.

Άρθρο αναφοράς: Ali Moh Zaki και άλλοι. Απομόνωση ενός νέου Coronavirus από έναν άνδρα με πνευμονία στη Σαουδική Αραβία. The New England Journal of Medicine, 367: 19, Νοέμβριος 2012.

Το γενετικό υλικό εξάγεται απευθείας από το υπερκείμενο της καλλιέργειας και το δείγμα πτυέλων με ένα εργαλείο που ονομάζεται High Puré Viral Nucleic Acid Kit και στη συνέχεια δοκιμάζεται με διαφορετικά PCR για διάφορους γνωστούς μικροοργανισμούς. Δεν υπάρχει καμία αναφορά στον καθαρισμό και δεν υπάρχουν έλεγχοι.

Εν ολίγοις, αυτό που είχε γίνει με τους πρώτους κοροναϊούς – και με πολλούς άλλους υποτιθέμενους ιούς – είναι η καλλιέργεια υποτιθέμενων μολυσμένων ιστών – οποιαδήποτε “κυτταροπαθητική επίδραση” αποδόθηκε στην παρουσία ενός ιού μόνο – και στη συνέχεια είτε λαμβάνονται κάποιες πρωτεΐνες οι οποίες χωρίς οποιαδήποτε δοκιμή θεωρούνται “αντιγόνα ιού” και όταν αυτά τα “αντιγόνα” ανιχνεύονται σε καλλιέργειες, ερμηνεύεται ως “απομόνωση”, ή εξάγονται θραύσματα νουκλεϊκών οξέων με την προϋπόθεση ότι ανήκουν σε έναν ιό.

Εξηγήσαμε ήδη στο άρθρο που δημοσιεύθηκε στο προηγούμενο τεύχος του περιοδικού ότι, σύμφωνα με τον Δρ. Στέφαν Λάνκα, το λεγόμενο ‘‘κυτταροπαθητικό αποτέλεσμα” είναι στην πραγματικότητα ένα αποτέλεσμα που προκαλείται από τις συνθήκες του ίδιου του πολιτισμού. Αυτό αναγνωρίζεται για παράδειγμα στο άρθρο που προκαλείται από αντιβιοτικά απελευθέρωση μικρών εξωκυτταρικών κυστιδίων (εξωσώματα) με επιφανειακό DNA που δημοσιεύθηκε στις 15 Αυγούστου 2017 στον ιστότοπο του Nature και υπογράφηκε από τον Andrea Németh και άλλους.


Εξηγεί ότι ορισμένες ουσίες –όπως τα αντιβιοτικά– που προστίθενται σε πειράματα in vitro μπορούν να στρεσάρουν τις κυτταρικές καλλιέργειες έτσι ώστε να δημιουργούν νέες ακολουθίες που δεν είχαν εντοπιστεί στο παρελθόν. Αυτό είχε ήδη παρατηρηθεί από κάποιον άλλο από τη Δρ. Barbara McClintock το 1983 κατά τη διάρκεια της διάλεξης για το βραβείο Νόμπελ, όπως φαίνεται στη διεύθυνση https://www.nobelprize.org/uploads/2018/06 /mcclintock-lecture.pdf

Στην ουσία, ΚΑΝΕΝΑΣ ΑΠΟ ΤΟΥΣ ΥΠΟΤΙΘΕΜΕΝΟΥΣ ΑΝΘΡΩΠΙΝΟΥΣ ΚΟΡΟΝΟΙΟΥΣ, ΔΕΝ ΕΧΕΙ ΑΠΟΜΟΝΩΘΕΙ. Το μόνο πράγμα που διαφέρει μεταξύ τους είναι οι εργαστηριακές διαδικασίες και τεχνικές που έγιναν προοδευτικά πιο εξελιγμένες, οι οποίες, στην περίπτωση αυτή, δεν συνεπάγονταν μεγαλύτερη ακρίβεια, αλλά μεγαλύτερη ικανότητα εξαπάτησης και αυταπάτης που κατέληξε στην εικονική κατασκευή του SARS-CoV-2.

Και η προφανής συνέπεια της έλλειψης αποδεικτικών στοιχείων για την απομόνωσή τους είναι ότι αυτοί οι ”κοροναϊοί” δεν μπορούν να θεωρηθούν υπεύθυνοι για οποιαδήποτε ασθένεια. Επιπλέον, όλες οι διαγνωστικές εξετάσεις – οποιουδήποτε είδους – με βάση τα υποτιθέμενα συστατικά αυτών των “ιών” (νουκλεϊκά οξέα ή πρωτεΐνες) αποκλείονται εντελώς ως “δοκιμασίες μόλυνσης” και ακόμη περισσότερο ως “διαγνωστικά” ασθενειών.


Στο προηγούμενο τεύχος συλλέξαμε ήδη τις απαντήσεις που δόθηκαν από τους συγγραφείς πολλών άρθρων που υποτίθεται ότι περιγράφουν την απομόνωση του SARS-CoV-2 στο οποίο αναγνώρισαν ότι δεν είχαν ”καθαριστεί”, πράγμα που σημαίνει σιωπηρά αναγνώριση ότι ο ιός δεν ήταν απομονωμένος. Και τώρα θα προσθέσουμε ένα ακόμη αποδεικτικό στοιχείο: τις απαντήσεις που δόθηκαν από διάφορες αρχές – πολιτική και υγεία – από διάφορες χώρες σχετικά με τον καθαρισμό και την απομόνωση του SARS-CoV-2.

Ο James McCumiskey – συγγραφέας του βιβλίου The Latest ConspiracyThe Biomedical Paradigm – μας λέει ότι το Εθνικό Εργαστήριο Αναφοράς για Ιούς της Ιρλανδίας ζήτησε πληροφορίες σχετικά με αυτό από το Πανεπιστήμιο του Δουβλίνου και το τελευταίο απάντησε ότι “δεν έχει αρχεία που θα μπορούσαν να δώσουν απάντηση το αίτημά τους “. Ο διευθυντής νομικών υπηρεσιών του εργαστηρίου επέμεινε στο αίτημά του προς το πανεπιστήμιο και το πανεπιστήμιο απάντησε ως εξής: “Η θέση του πανεπιστημίου είναι ότι το υλικό της ακαδημαϊκής συζήτησης δεν μπορεί να υπόκειται στον νόμο περί ελευθερίας της πληροφόρησης”.

Από το αίτημα της NVR προκύπτει ότι δεν έχουν καλλιεργήσει το SARS-CoV-2 ή δεν τον έχουν καθαρίσει. Αναγνωρίζουν μόνο ότι “ανίχνευσαν SARS-CoV-2 RNA σε διαγνωστικά δείγματα.”

Στις 22 Ιουνίου, μια ομάδα εμπειρογνωμόνων έστειλε μια διαβούλευση με παρόμοιο τρόπο στον πρωθυπουργό της Βρετανίας Μπόρις Τζόνσον. Η επιστολή υπογράφηκε από τον Δρ Kevin Corbett, Piers Corbyn – καθηγητή στο Imperial College London -, τον μηχανικό και ανεξάρτητο ερευνητή – τον οποίο πήραμε συνέντευξη στο περιοδικό εκείνη την εποχή – David CroweDr. Andrew Kaufman, καθηγητή βιολογίας του Εδιμβούργου, Roger  Watson και ο βιολόγος και χημικός David Rasnick – και μέχρι σήμερα δεν έχουν ακόμη λάβει απάντηση!

Ένα άλλο παρόμοιο αίτημα – σε αυτήν την περίπτωση προς το Εθνικό Συμβούλιο Έρευνας του Καναδά – έλαβε την ακόλουθη απάντηση: “Δεν μπορέσαμε να πραγματοποιήσουμε πλήρη αναζήτηση των αρχείων του NRC, οπότε λυπούμαστε που σας πληροφορούμε ότι δεν έχουν εντοπιστεί αρχεία που να ανταποκρίνονται στο αίτημά σας. “ Θα προσθέσουμε ότι δύο δημοσιογράφοι έχουν στείλει παρόμοια αιτήματα – βάσει του νόμου περί ελευθερίας της πληροφόρησης – σε διάφορα ιδρύματα στον Καναδά, τη Νέα Ζηλανδία, την Αυστραλία, τη Γερμανία, το Ηνωμένο Βασίλειο και τις Ηνωμένες Πολιτείες και από τις 5 Σεπτεμβρίου, δώδεκα ιδρύματα απάντησαν , όλα απάντησαν το ίδιο πράγμα: ότι δεν έχουν κανένα αρχείο εργασίας που να περιγράφει την απομόνωση του ιού που υποτίθεται ότι προκαλεί την Covid-19.

U.K. Department of Health and Social Care has no record of “COVID-19 virus” isolation

A colleague in New Zealand and I have been submitting Freedom of Information requests to various institutions in Canada, NZ, Australia, Germany, the U.K., the U.S. etc., seeking any records that describe the isolation of a “COVID-19 virus” (aka “SARS-COV-2”) from an unadulterated sample taken from a diseased human. The reason for our requests is … Continue reading U.K. Department of Health and Social Care has no record of “COVID-19 virus” isolation

Fluoride Free Peel

Ψάχνοντας για την καταγωγή του ψεύτικου GENOME

Το ερώτημα που αναρωτηθήκαμε τότε ήταν: εάν οι ακολουθίες που έχουν δημοσιευτεί δεν ανήκουν – όπως ισχυρίζεται – σε νέους ιούς, από πού προέρχονται;

Και για να απαντήσουμε σε αυτήν την ερώτηση, αποφασίσαμε να πραγματοποιήσουμε μια αναζήτηση με ένα πρόγραμμα υπολογιστή που ονομάζεται Basic Local Alignment Search Tool (BLAST), ένα εργαλείο αναζήτησης ευθυγράμμισης ακολουθιών που μας επιτρέπει να συγκρίνουμε μια δεδομένη ακολουθία με όλες τις ακολουθίες που είναι αποθηκευμένες στα Εθνικά Ινστιτούτα Υγείας των Ηνωμένων Πολιτειών (είναι δημόσια και μπορείτε να συμβουλευτείτε τη διεύθυνση https://blast.ncbi.nlm.nih.gov/Blast.cgi.

Εξηγούμε βήμα προς βήμα τι κάναμε έτσι ώστε οι αναγνώστες μας να μπορούν να επαναλάβουν την αναζήτηση για και ελέγξτε τα αποτελέσματα.

Αρχικά συλλέξαμε όλους τους εκκινητές των PCR που περιγράφονται στα πρωτόκολλα που φιλοξενούνται στον ιστότοπο της ΠΟΥ κατά τον χρόνο που ήταν αυτά:

Πρωτόκολλο CDC της Κίνας: χρησιμοποιεί γονίδια ORF1ab και N ως στόχο.
Πρωτόκολλο του Ινστιτούτου Pasteur (Γαλλία): χρησιμοποιεί δύο θραύσματα του RdRP (το οποίο υποτίθεται ότι είναι ειδικό για το SARS.CoV-2).
Πρωτόκολλο CDC των Ηνωμένων Πολιτειών: χρησιμοποιεί τρία τμήματα του γονιδίου Ν.
Πρωτόκολλο του Εθνικού Ινστιτούτου Λοιμωδών Νοσημάτων της Ιαπωνίας: είναι το μόνο που έχει ως στόχο το γονίδιο S μαζί με άλλα γονίδια που υποτίθεται ότι μοιράζονται με άλλους κοροναϊούς.
Πρωτόκολλο Charite (Γερμανία): χρησιμοποιεί τα γονίδια E, N και RdRP.
Πρωτόκολλο Πανεπιστημίου του Χονγκ Κονγκ: χρησιμοποιεί γονίδια ORF1b-nsp14 και N.
Πρωτόκολλο του Εθνικού Ινστιτούτου Υγείας της Ταϊλάνδης: χρησιμοποιεί το γονίδιο Ν.
Στη συνέχεια, εισαγάγαμε την ακολουθία των εκκινητών – αυτή που δείχνει την αρχή της ακολουθίας που θα ανιχνευθεί (προς τα εμπρός) και αυτή που δείχνει την τελική (αντίστροφη) – στο BLAST, ώστε να μπορεί να τα αναζητήσει σε δύο βάσεις δεδομένων: συλλογή γονιδιωμάτων μικροβίων και αυτό που αντιστοιχεί στο ανθρώπινο γονιδίωμα.


Ας δούμε λεπτομερώς τη διαδικασία λαμβάνοντας ως παράδειγμα τους εκκινητές του Γαλλικού πρωτοκόλλου. Όταν βρισκόμασταν στον ιστότοπο BLAST, επιλέξαμε τα μικρόβια για αναζήτηση στις βάσεις δεδομένων του μικροβιακού γονιδιώματος και μετακινηθήκαμε στην επόμενη σελίδα. Στη συνέχεια εμφανίστηκε μια φόρμα στην οποία βάλαμε την ακολουθία του εμπρόσθιου εκκινητή του Γαλλικού πρωτοκόλλου – που είναι ATGAGCTTAGTCCTGTG-, επιλέξαμε την επιλογή Εξαιρετικά παρόμοιες ακολουθίες και πιέσαμε το πλήκτρο BLAST. Λίγα δευτερόλεπτα αργότερα εμφανίστηκαν τα αποτελέσματα – πήραμε ένα στιγμιότυπο οθόνης – και μας δείχτηκαν 100 ακολουθίες μικροβίων – ιδιαίτερα βακτηρίων και αρχαίων – με σύμπτωση μεταξύ 77% και 100% με ποσοστό ταυτότητας 100%.

Στη συνέχεια επιστρέψαμε στην αρχική σελίδα και εκείνη τη δεύτερη φορά επιλέξαμε τον άνθρωπο για αναζήτηση του ανθρώπινου γονιδιώματος, επαναλάβαμε την ίδια λειτουργία και μετά από λίγα δευτερόλεπτα εμφανίστηκε το αποτέλεσμα που καταγράψαμε ξανά . Και αποδεικνύεται ότι η αλληλουχία που εισήχθη συμπίπτει με 74 αλληλουχίες του ανθρώπινου γονιδιώματος, με σύμπτωση μεταξύ 66% και 100% και ποσοστό ταυτότητας 100%.

Και αυτό δείχνει ότι η ακολουθία αυτού του αρχικού εκκινητή PCR που υποτίθεται ότι είναι ειδικός για το SARS-CoV-2 αντιστοιχεί στην πραγματικότητα σε 74 θραύσματα του ανθρώπινου γονιδιώματος και εκατό μικροβιακά θραύσματα επίσης!

Στη συνέχεια, αποφασίσαμε να επαναλάβουμε τη λειτουργία, αλλά με τον τελικό ή αντίστροφο εκκινητή – που είναι CTCCCTTTGTGTGTGT – και τα αποτελέσματα ήταν παρόμοια.

Δεδομένου ότι αυτές ήταν πολύ μικρές ακολουθίες – περίπου είκοσι γενετικά γράμματα ή νουκλεοτίδια – αποφασίσαμε να δοκιμάσουμε ξανά αλλά με την ακολουθία στόχο που ορίζεται από αυτούς τους δύο εκκινητές, δηλαδή την ακολουθία του υποτιθέμενου γονιδιώματος SARS-CoV-2 που βρίσκεται μεταξύ του αρχικού εκκινητή και του τελικού εκκινητή.

Προφανώς, για αυτό χρειαζόμασταν την ακολουθία που ισχυρίζεται επίσημα ότι είναι το “γονιδίωμα SARS-CoV-2” και παρόλο που χιλιάδες εργαστήρια ισχυρίζονται ότι το έχουν απομονώσει και αλληλουχήσει – έναν ψεύτικο ισχυρισμό όπως έχουμε εξηγήσει σε προηγούμενες εκθέσεις – αποφασίσαμε να μεταβείτε στον ιστότοπο του Εθνικού Κέντρου Βιοτεχνολογίας: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903.

Μόλις φτάσαμε εκεί, εντοπίσαμε την ”αλληλουχία στόχο”, ένα τμήμα 108 νουκλεοτιδίων που βρίσκεται μεταξύ των θέσεων 12.690 και 12.797 του ”γονιδιώματος”, το οποίο είναι αυτό:


Με αυτό επαναλάβαμε τα βήματα που περιγράφηκαν προηγουμένως και τα αποτελέσματα ήταν και πάλι εκπληκτικά αφού εμφανίστηκαν και πάλι εκατό μικροβιακές ακολουθίες με ποσοστό αντιστοιχίας 100% και τέσσερις αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 83% και 95%. Οι ομοιομορφίες ήταν επομένως χαμηλότερες, αλλά το σημαντικό είναι ότι συνεχίζουμε να βρίσκουμε τμήματα της υποτιθέμενης ”ακολουθίας στόχου” του SARS-CoV-2 τόσο σε μικρόβια όσο και στο δικό μας γονιδίωμα.

Πραγματικά έκπληκτοι κάναμε ένα ακόμη βήμα και δοκιμάσαμε με το γονίδιο που θεωρήθηκε εκείνη την εποχή ως το πιο ειδικό του SARS-CoV-2, το γονίδιο Ε που υποτίθεται ότι δημιουργεί τις πρωτεΐνες φακέλου και βρίσκεται μεταξύ των θέσεων 26.245 και 26.472

Επαναλάβαμε με αυτό τα βήματα που έχουν ήδη περιγραφεί και το αποτέλεσμα ήταν ακόμη πιο εκπληκτικό, διότι παρά το μήκος του εμφανίστηκαν εκατοντάδες μικροβιακές ακολουθίες με ποσοστό ταυτότητας 100% και 10 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 80% και 100% . Και παρόμοια αποτελέσματα ελήφθησαν με ένα θραύσμα που επιλέχθηκε τυχαία και με το γονίδιο Ν που λένε ότι αντιστοιχεί στις πρωτεΐνες του νουκλεοκαψιδίου SARS-CoV-2.

Τελικά αποφασίσαμε να δοκιμάσουμε με το γονίδιο S που λέγεται ότι δημιουργεί τις δομικές πρωτεΐνες ”ακίδων” που είναι το κλειδί για την είσοδο στο κύτταρο και στη συνέχεια θεωρήθηκε ότι είναι το πιο ειδικό γονίδιο SARS-CoV-2. Δεδομένου ότι είναι ένα γονίδιο του οποίου η αλληλουχία είναι πολύ μεγαλύτερη – 3821 νουκλεοτίδια μεταξύ των θέσεων 21.563 και 25.384 – δοκιμάσαμε με δύο θραύσματα που επιλέχθηκαν τυχαία μέσα σε αυτό το γονίδιο και το πρώτο – TTGGCAAAATTCAAGACTCACTTTC – είχε ως αποτέλεσμα άλλες εκατοντάδες μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος και το δεύτερο – CTTGCTGCTACTAAATGCAGAGTGT – εκατό μικροβιακές αλληλουχίες και 90 του ανθρώπινου γονιδιώματος.

Τελικά αποφασίσαμε να δοκιμάσουμε με τους εκκινητές του Πρωτοκόλλου της Ιαπωνίας, το μόνο που περιλαμβάνει τις αλληλουχίες στόχου του γονιδίου S και, ο αναγνώστης θα είχε ήδη μαντέψει, τα αποτελέσματα ήταν και πάλι παρόμοια: εκατό μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 94,12% και 100%!


Η συνέπεια όλων αυτών που μόλις εξηγήσαμε είναι σαφής και άμεση: ΔΕΝ ΥΠΑΡΧΕΙ ΚΑΜΙΑ ΕΓΚΥΡΗ ΔΟΚΙΜΗ ΓΙΑ ΑΝΙΧΝΕΥΣΗ ΤΟΥ SARS-COV-2, ούτε δοκιμές αντισωμάτων ή αντιγόνων ούτε RT-PCR. Και συμπεριλάβαμε αυτά που βασίζονται στο υποτιθέμενο γονίδιο που κωδικοποιεί την πρωτεΐνη S1 ή spike. Και αυτό σημαίνει ότι ΟΛΟΙ ΟΙ ΑΡΙΘΜΟΙ “ΠΕΡΙΠΤΩΣΕΩΝ”, “ΜΟΛΥΝΣΕΩΝ”, “ΦΟΡΕΩΝ”, “ΑΣΥΜΠΩΜΑΤΙΚΟΙ” Ή “ΠΕΘΑΝΑΝ ΑΠΟ ΤΗΝ COVID-19-” ΕΙΝΑΙ ΧΩΡΙΣ ΕΠΙΣΤΗΜΟΝΙΚΗ ΒΑΣΗ ΚΑΙ ΟΛΑ ΤΑ “ΘΕΤΙΚΑ” ΕΙΝΑΙ ΨΕΥΔΩΣ ΘΕΤΙΚΑ, κάτι που πρέπει να κοινοποιηθεί αμέσως σε εκείνους που επηρεάστηκαν. και οι υπεύθυνοι πρέπει να λογοδοτήσουν.

Τελειώνουμε προσθέτοντας ότι ακόμη και ο ίδιος ο ΠΟΥ δεν πιστεύει πραγματικά σε αυτές τις δοκιμές. Απλώς διαβάστε το έγγραφο που δημοσιεύθηκε τον περασμένο Σεπτέμβριο ως εργαστηριακός οδηγός για το SARS-CoV-2 με τίτλο Διαγνωστικά τεστ για το SARS-CoV-2 – είναι διαθέσιμο στη διεύθυνση https://apps.who.int/iris/rest/bitstreams/1302661/ ανακτήστε – και λέει κυριολεκτικά στη σελίδα 5:

Testing for SARS-CoV-2
Nucleic acid amplification test (NAAT)
Wherever possible, suspected active SARS-CoV-2 infections should be tested with NAAT, such as rRT-PCR. NAAT assays should target the SARS-CoV-2 genome. Since there is currently no known circulation of SARS-CoV-1 globally,  a sarbecovirus-specific sequence is also a reasonable target. For commercial assays, interpretation of results should be done according to the instructions for use. Optimal diagnostics consist of a NAAT assay with at least two independent targets on the SARS-CoV-2 genome, however, in areas with widespread transmission of SARS-CoV-2, a simple algorithm might be adopted with one single discriminatory target.”

“Όποτε είναι δυνατόν, η ύποπτη ενεργός λοίμωξη θα πρέπει να δοκιμάζεται με μια δοκιμή ενίσχυσης νουκλεϊκών οξέων (NAAT) όπως το RT-PCR. Οι δοκιμές NAAT πρέπει να στοχεύουν το γονιδίωμα SARS-CoV-2, αλλά επειδή δεν υπάρχει καμία γνωστή παγκόσμια κυκλοφορία του SARS-CoV-1 μια ακολουθία Sarbecovirus (η ακολουθία Sarbecovirus  υποτίθεται ότι περιλαμβάνει τουλάχιστον πέντε ιούς ανθρώπου και ζώου συμπεριλαμβανομένων των SARS-CoV-1 και SARS-Cov-2) είναι επίσης ένας λογικός στόχος “. Δηλαδή, ο ΠΟΥ συμφωνεί να χρησιμοποιήσει μη ειδικές ακολουθίες για την ανίχνευση του SARS-CoV-2.

Αυτό δεν συμβαίνει μόνο επειδή το εγχειρίδιο αναφέρει αργότερα, “Μια βέλτιστη διάγνωση αποτελείται από μια δοκιμή NAAT με τουλάχιστον δύο στόχους ανεξάρτητους από το γονιδίωμα του SARS-CoV-2. Ωστόσο, σε περιοχές όπου η μετάδοση είναι ευρέως διαδεδομένη, ένας απλός αλγόριθμος ενός στόχου μπορεί να χρησιμοποιηθεί. Για εμπορικούς προσδιορισμούς, η ερμηνεία των αποτελεσμάτων πρέπει να γίνεται σύμφωνα με τις οδηγίες χρήσης. Τα βέλτιστα διαγνωστικά στοιχεία αποτελούνται από μια δοκιμασία NAAT με τουλάχιστον δύο ανεξάρτητους στόχους στο γονιδίωμα SARS-CoV-2, ωστόσο, σε περιοχές με ευρεία μετάδοση του SARS-CoV-2, ένας απλός αλγόριθμος μπορεί να υιοθετηθεί με έναν μόνο στόχο. “

Το εγχειρίδιο του ΠΟΥ αναφέρει, “Ένα ή περισσότερα αρνητικά αποτελέσματα δεν αποκλείουν απαραίτητα τη μόλυνση SARS-CoV-2. Υπάρχουν διάφοροι παράγοντες που μπορούν να προκαλέσουν αρνητικό αποτέλεσμα σε ένα μολυσμένο άτομο, συμπεριλαμβανομένης της κακής ποιότητας του δείγματος, καθυστερημένη συλλογή του δείγματοςανεπαρκής χειρισμός ή τεχνικοί λόγοι που είναι εγγενείς στη δοκιμή, όπως μετάλλαξη του ιού ή αναστολή της PCR. “

Τι περιμένουν οι δικαστές να ενεργήσουν με δική τους πρωτοβουλία;

Jesus Garcia Blanca

Σημείωση: ο συγγραφέας ευχαριστεί δημόσια τον Juan Pedro Aparicio Alcaraz για την υπομονετική και σχολαστική συνεργατική του εργασία στην αναζήτηση επιστημονικών άρθρων και για την κουραστική δουλειά του με το BLAST.

ΑΥΤΗ Η ΕΚΘΕΣΗ ΕΜΦΑΝΙΖΕΤΑΙ ΣΤΟ (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)

Ανεπίσημη αγγλική μετάφραση από το ”Απάτες και ψέματα στον ιατρικό τομέα» που δημοσιεύθηκε αρχικά στο www.dsalud.com



Αξιολογήστε Το


Συναφή Άρθρα

Μπορεί να σας αρέσει...

1 Response

Αφήστε μια απάντηση

Η ηλ. διεύθυνση σας δεν δημοσιεύεται. Τα υποχρεωτικά πεδία σημειώνονται με *